What is their proper sequence for these steps?

1. translation
2. RNA processing
3. transcription
4. modification of protein

Consider a DNA coding strand with the following sequence:  3'-C T T C A T A G C T C G-5'.

Use the genetic code to determine the corresponding amino acid sequence of the translated protein.

      DNA Coding Strand: 3'- C  T  T  C  A  T  A  G  C  T  C  G -5'

               mRNA Strand:

         Protein Sequence:

Which of the following polypeptide chains are synthesized from the RNA sequence:

5' – AUGAUCCGAAGUGGCACAGCAUAA - 3'

What is the central dogma of molecular biology directly referring to?