Skip to main content
Ch. 16 - Genomics: Genetics from a Whole-Genome Perspective
Sanders - Genetic Analysis: An Integrated Approach 3rd Edition
Sanders3rd EditionGenetic Analysis: An Integrated ApproachISBN: 9780135564172Not the one you use?Change textbook
All textbooksSanders 3rd EditionCh. 16 - Genomics: Genetics from a Whole-Genome PerspectiveProblem B.14e
Chapter 16, Problem B.14e

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:
The duration of treatment

Verified step by step guidance
1
Identify a hereditary condition from the Recommended Uniform Screening Panel (RUSP) core or secondary conditions list. Examples include Phenylketonuria (PKU), Cystic Fibrosis, or Sickle Cell Disease.
Research reliable sources such as medical databases, genetics textbooks, or official health organization websites to gather information about the chosen condition.
Focus specifically on finding details about the duration of treatment for the condition. Treatment duration can vary depending on the condition's nature, severity, and patient response.
Summarize the treatment duration, noting whether it is lifelong, time-limited, or variable based on individual cases.
Optionally, note any factors that influence treatment duration, such as age at diagnosis, treatment adherence, or advancements in therapy.

Verified video answer for a similar problem:

This video solution was recommended by our tutors as helpful for the problem above.
Video duration:
2m
Was this helpful?

Key Concepts

Here are the essential concepts you must grasp in order to answer the question correctly.

Newborn Screening and the RUSP

The Recommended Uniform Screening Panel (RUSP) is a list of core and secondary conditions that newborns are screened for across the United States. It guides early detection of genetic and metabolic disorders to enable timely intervention. Understanding RUSP helps contextualize why certain hereditary conditions are prioritized for screening.
Recommended video:
Guided course
09:32
History and Experiments

Hereditary Conditions and Genetic Basis

Hereditary conditions are disorders passed from parents to offspring through genes. These conditions often involve mutations affecting protein function or metabolism. Recognizing the genetic basis is essential for understanding disease mechanisms and the rationale behind treatment strategies.
Recommended video:
Guided course
07:39
Genetic Cloning

Treatment Duration and Management of Genetic Disorders

Treatment duration for hereditary conditions varies widely, from lifelong management to limited courses of therapy. It depends on the nature of the disorder, severity, and available interventions. Knowing treatment timelines is crucial for patient care planning and evaluating prognosis.
Recommended video:
Guided course
06:04
Mapping Bacteriophages
Related Practice
Textbook Question

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:

The symptoms and consequences of the condition if it is not treated.

Textbook Question

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:

The defect that characterizes the condition.

1
views
Textbook Question

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information: The frequency of the condition in newborn infants (note any populations in which the condition is more frequent)

Textbook Question

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:

The anticipated outcome if treatment is applied

Textbook Question

Select one of the hereditary conditions from either the RUSP core conditions list or the RUSP list of secondary conditions and do some online research to find the following information:

The recommended treatment for those with the condition.

Textbook Question

In the course of the Drosophila melanogaster genome project, the following genomic DNA sequences were obtained. Try to assemble the sequences into a single contig.

5' TTCCAGAACCGGCGAATGAAGCTGAAGAAG 3'

5' GAGCGGCAGATCAAGATCTGGTTCCAGAAC 3'

5' TGATCTGCCGCTCCGTCAGGCATAGCGCGT 3'

5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'

5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'

5' CCATCTCGATTCTCCGTCTGCGGGTCAGAT 3'

Go to the URL provided in Problem 14, and using the sequence you have just assembled, perform a blastn search in the 'Nucleotide collection (nr/nt)' database. Does the search produce sequences similar to your assembled sequence, and if so, what are they? Can you tell if your sequence is transcribed, and if it represents protein-coding sequence? Perform a tblastx search, first choosing the 'Nucleotide collection (nr/nt)' database and then limiting the search to human sequences by typing Homo sapiens in the organism box. Are homologous sequences found in the human genome? Annotate the assembled sequence.