A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA 5′… ACGCAUUACGUGGCUAGACAUUUAGC– CGAUCAGACUAGACAGCGCGCUAGCG– AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC– GAGGGCACAUAGUCUA … 3′ Genomic. 5′… ACGCATTACGTGGCTAGACATTTAGC– Coding CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand TACCTCAAGCCAUAATAGACAGTAGA– DNA CATTGAAAGACATAGATAGACATAGAGA– CTTAGACATACGACGGACATACCAAGAC– GAATACGAACACTATACAGCCUCAGTAGCGC– TAAAGCTGACTCGCGATCAGTCTCGAGGGCA– CATAGTCTA…3′ There is one intron in the DNA sequence shown. Locate the intron and underline the splice site sequences.
Table of contents
- 1. Introduction to Genetics51m
- 2. Mendel's Laws of Inheritance3h 37m
- 3. Extensions to Mendelian Inheritance2h 41m
- 4. Genetic Mapping and Linkage2h 28m
- 5. Genetics of Bacteria and Viruses1h 21m
- 6. Chromosomal Variation1h 48m
- 7. DNA and Chromosome Structure56m
- 8. DNA Replication1h 10m
- 9. Mitosis and Meiosis1h 34m
- 10. Transcription1h 0m
- 11. Translation58m
- 12. Gene Regulation in Prokaryotes1h 19m
- 13. Gene Regulation in Eukaryotes44m
- 14. Genetic Control of Development44m
- 15. Genomes and Genomics1h 50m
- 16. Transposable Elements47m
- 17. Mutation, Repair, and Recombination1h 6m
- 18. Molecular Genetic Tools19m
- 19. Cancer Genetics29m
- 20. Quantitative Genetics1h 26m
- 21. Population Genetics50m
- 22. Evolutionary Genetics29m
10. Transcription
RNA Modification and Processing
Struggling with Genetics?
Join thousands of students who trust us to help them ace their exams!Watch the first videoMultiple Choice
Which of the following is NOT a method of mRNA modification?
A
5' cap
B
3' Poly-A tail
C
Methylation
D
Splicing
Verified step by step guidance1
Understand the concept of mRNA modification: mRNA modification is a process that occurs in eukaryotic cells where the primary mRNA transcript undergoes several changes before it is translated into a protein.
Identify the common methods of mRNA modification: The primary methods include the addition of a 5' cap, the addition of a 3' Poly-A tail, and splicing.
Explain the 5' cap addition: This involves adding a modified guanine nucleotide to the 5' end of the mRNA, which helps protect the mRNA from degradation and assists in ribosome binding during translation.
Explain the 3' Poly-A tail addition: This involves adding a long chain of adenine nucleotides to the 3' end of the mRNA, which also helps protect the mRNA from degradation and aids in the export of the mRNA from the nucleus.
Explain splicing: This process involves the removal of non-coding sequences (introns) from the mRNA transcript and the joining of coding sequences (exons) to produce a mature mRNA molecule that can be translated into a protein.
Related Videos
Related Practice
Open Question
RNA Modification and Processing practice set

