Recent observations indicate that alternative splicing is a common way for eukaryotes to expand their repertoire of gene functions. Studies indicate that approximately 50 percent of human genes exhibit alternative splicing and approximately 15 percent of disease-causing mutations involve aberrant alternative splicing. Different tissues show remarkably different frequencies of alternative splicing, with the brain accounting for approximately 18 percent of such events [Xu et al. (2002). Nucl. Acids Res. 30:3754–3766].

Why might some tissues engage in more alternative splicing than others?

Substitution RNA editing is known to involve either C-to-U or A-to-I conversions. What common chemical event accounts for each?

Genomic DNA from a mouse is isolated, fragmented, and denatured into single strands. It is then mixed with mRNA isolated from the cytoplasm of mouse cells. The image represents an electron micrograph result showing the hybridization of single-stranded DNA and mRNA. Based on this electron micrograph image, how many introns and exons are present in the mouse DNA fragment shown? <>

A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA              5′… ACGCAUUACGUGGCUAGACAUUUAGC–                                 CGAUCAGACUAGACAGCGCGCUAGCG–                         AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC–                        GAGGGCACAUAGUCUA … 3′ Genomic.        5′… ACGCATTACGTGGCTAGACATTTAGC– Coding            CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand             TACCTCAAGCCAUAATAGACAGTAGA– DNA                CATTGAAAGACATAGATAGACATAGAGA–                       CTTAGACATACGACGGACATACCAAGAC–                       GAATACGAACACTATACAGCCUCAGTAGCGC–                       TAAAGCTGACTCGCGATCAGTCTCGAGGGCA–                       CATAGTCTA…3′ Does this intron contain normal splice-site sequences?

A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA              5′… ACGCAUUACGUGGCUAGACAUUUAGC–                                 CGAUCAGACUAGACAGCGCGCUAGCG–                         AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC–                        GAGGGCACAUAGUCUA … 3′ Genomic.        5′… ACGCATTACGTGGCTAGACATTTAGC– Coding            CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand             TACCTCAAGCCAUAATAGACAGTAGA– DNA                CATTGAAAGACATAGATAGACATAGAGA–                       CTTAGACATACGACGGACATACCAAGAC–                       GAATACGAACACTATACAGCCUCAGTAGCGC–                       TAAAGCTGACTCGCGATCAGTCTCGAGGGCA–                       CATAGTCTA…3′ There is one intron in the DNA sequence shown. Locate the intron and underline the splice site sequences.

Isoginkgetin is a cell-permeable chemical isolated from the Ginkgo biloba tree that binds to and inhibits snRNPs. Would this be most problematic for E. coli cells, yeast cells, or human cells? Why?

Isoginkgetin is a cell-permeable chemical isolated from the Ginkgo biloba tree that binds to and inhibits snRNPs.

What types of problems would you anticipate in cells treated with isoginkgetin?

Which of the following is NOT a method of mRNA modification?

The spliceosome is made up of which of the following components?