One form of posttranscriptional modification of most eukaryotic pre-mRNAs is the addition of a poly-A sequence at the 3' end. The absence of a poly-A sequence leads to rapid degradation of the transcript. Poly-A sequences of various lengths are also added to many bacterial RNA transcripts where, instead of promoting stability, they enhance degradation. In both cases, RNA secondary structures, stabilizing proteins, or degrading enzymes interact with poly-A sequences. Considering the activities of RNAs, what might be general functions of 3'-polyadenylation?
Table of contents
- 1. Introduction to Genetics51m
- 2. Mendel's Laws of Inheritance3h 37m
- 3. Extensions to Mendelian Inheritance2h 41m
- 4. Genetic Mapping and Linkage2h 28m
- 5. Genetics of Bacteria and Viruses1h 21m
- 6. Chromosomal Variation1h 48m
- 7. DNA and Chromosome Structure56m
- 8. DNA Replication1h 10m
- 9. Mitosis and Meiosis1h 34m
- 10. Transcription1h 0m
- 11. Translation58m
- 12. Gene Regulation in Prokaryotes1h 19m
- 13. Gene Regulation in Eukaryotes44m
- 14. Genetic Control of Development44m
- 15. Genomes and Genomics1h 50m
- 16. Transposable Elements47m
- 17. Mutation, Repair, and Recombination1h 6m
- 18. Molecular Genetic Tools19m
- 19. Cancer Genetics29m
- 20. Quantitative Genetics1h 26m
- 21. Population Genetics50m
- 22. Evolutionary Genetics29m
10. Transcription
RNA Modification and Processing
Struggling with Genetics?
Join thousands of students who trust us to help them ace their exams!Watch the first videoOpen Question
A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA 5′… ACGCAUUACGUGGCUAGACAUUUAGC– CGAUCAGACUAGACAGCGCGCUAGCG– AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC– GAGGGCACAUAGUCUA … 3′ Genomic. 5′… ACGCATTACGTGGCTAGACATTTAGC– Coding CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand TACCTCAAGCCAUAATAGACAGTAGA– DNA CATTGAAAGACATAGATAGACATAGAGA– CTTAGACATACGACGGACATACCAAGAC– GAATACGAACACTATACAGCCUCAGTAGCGC– TAAAGCTGACTCGCGATCAGTCTCGAGGGCA– CATAGTCTA…3′ Does this intron contain normal splice-site sequences?
Verified video answer for a similar problem:This video solution was recommended by our tutors as helpful for the problem above
Video duration:
2mPlay a video:
0 Comments
Related Videos
Related Practice
Open Question
RNA Modification and Processing practice set

