Describe the role of two forms of RNA editing that lead to changes in the size and sequence of pre-mRNAs. Briefly describe several examples of each form of editing, including their impact on respective protein products.

Answer these questions concerning promoters. What role do promoters play in transcription?

A short RNA molecule was isolated that demonstrated a hyperchromic shift (see Chapter 10), indicating secondary structure. Its sequence was determined to be

     5'-AGGCGCCGACUCUACU-3'

Propose a two-dimensional model for this molecule.

Present an overview of various forms of posttranscriptional RNA processing in eukaryotes. For each, provide an example.

One form of posttranscriptional modification of most eukaryotic pre-mRNAs is the addition of a poly-A sequence at the 3' end. The absence of a poly-A sequence leads to rapid degradation of the transcript. Poly-A sequences of various lengths are also added to many bacterial RNA transcripts where, instead of promoting stability, they enhance degradation. In both cases, RNA secondary structures, stabilizing proteins, or degrading enzymes interact with poly-A sequences. Considering the activities of RNAs, what might be general functions of 3'-polyadenylation?

Substitution RNA editing is known to involve either C-to-U or A-to-I conversions. What common chemical event accounts for each?

Genomic DNA from a mouse is isolated, fragmented, and denatured into single strands. It is then mixed with mRNA isolated from the cytoplasm of mouse cells. The image represents an electron micrograph result showing the hybridization of single-stranded DNA and mRNA. Based on this electron micrograph image, how many introns and exons are present in the mouse DNA fragment shown? <>

A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA              5′… ACGCAUUACGUGGCUAGACAUUUAGC–                                 CGAUCAGACUAGACAGCGCGCUAGCG–                         AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC–                        GAGGGCACAUAGUCUA … 3′ Genomic.        5′… ACGCATTACGTGGCTAGACATTTAGC– Coding            CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand             TACCTCAAGCCAUAATAGACAGTAGA– DNA                CATTGAAAGACATAGATAGACATAGAGA–                       CTTAGACATACGACGGACATACCAAGAC–                       GAATACGAACACTATACAGCCUCAGTAGCGC–                       TAAAGCTGACTCGCGATCAGTCTCGAGGGCA–                       CATAGTCTA…3′ Does this intron contain normal splice-site sequences?

A portion of a human gene is isolated from the genome and sequenced. The corresponding segment of mRNA is isolated from the cytoplasm of human cells, and it is also sequenced. The nucleic acid strings shown here are from genomic coding strand DNA and the corresponding mRNA. mRNA              5′… ACGCAUUACGUGGCUAGACAUUUAGC–                                 CGAUCAGACUAGACAGCGCGCUAGCG–                         AUAGCGCUAAAGCUGACUCGCGAUCAGUCUC–                        GAGGGCACAUAGUCUA … 3′ Genomic.        5′… ACGCATTACGTGGCTAGACATTTAGC– Coding            CGATCAGACTAGACAGCGCGCTAGCGAGTC– Strand             TACCTCAAGCCAUAATAGACAGTAGA– DNA                CATTGAAAGACATAGATAGACATAGAGA–                       CTTAGACATACGACGGACATACCAAGAC–                       GAATACGAACACTATACAGCCUCAGTAGCGC–                       TAAAGCTGACTCGCGATCAGTCTCGAGGGCA–                       CATAGTCTA…3′ There is one intron in the DNA sequence shown. Locate the intron and underline the splice site sequences.