Two complaints about some transgenic plants presently in commercial use are that (1) the Bt toxin gene is constitutively expressed in them, leading to fears that selection pressures will cause insects to evolve resistance to the toxin, and (2) a selectable marker gene—for example, conferring kanamycin resistance—remains in the plant, leading to concerns about increased antibiotic resistance in organisms in the wild. How would you generate transgenic plants that produce Bt only in response to being fed upon by insects and without the selectable marker?

You have generated three transgenic lines of maize that are resistant to the European corn borer, a significant pest in many regions of the world. The transgenic lines (T₁ in the accompanying table) were created using Agrobacterium-mediated transformation with a T-DNA having two genes, the first being a gene conferring resistance to the corn borer and the second being a gene conferring resistance to a herbicide that you used as a selectable marker to obtain your transgenic plants. You crossed each of the lines to a wild-type maize plant and also generated a T₂ population by self-fertilization of the T₁ plant. The following segregation results were observed (herbicide resistant : herbicide sensitive):

Cross                                     Line 1    Line 2    Line 3
Transgenic (T₁) × wild type       1:1        3:1         5:1
Self-cross (T₂)                           3:1      15:1       35:1

Explain these segregation ratios.

Bacterial Pseudomonas species often possess plasmids encoding genes involved in the catabolism of organic compounds. You have discovered a strain that can metabolize crude oil and wish to identify the gene(s) responsible. Outline an experimental protocol to find the gene or genes required for crude oil metabolism.

The highlighted sequence shown below is the one originally used to produce the B chain of human insulin in E. coli. The sequence of the human gene encoding the B chain of insulin was later determined from a cDNA isolated from a human pancreatic cDNA library and is also shown below, without highlighting. Explain the differences between the two sequences.

ATGTTCGTCAATCAGCACCTTTGTGGTTCTCACCTCGTTGAAGCTTTGTACCTTGTTTGCGGTGAACGTGGTTTCTTCTACACTCCTAAGACTTAA

GCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGC

As you will learn later in the text (Special Topics Chapter 1— CRISPR-Cas and Genome Editing), the CRISPR-Cas system has great potential but also raises many ethical issues about its potential applications because theoretically it can be used to edit any gene in the genome. What do you think are some of the concerns about the use of CRISPR-Cas on humans? Should CRISPR-Cas applications be limited for use on only certain human genes but not others? Explain your answers.

The gel presented here shows the pattern of bands of fragments produced with several restriction enzymes. The enzymes used are identified above the lanes of the gel, and six possible restriction maps are shown in the column to the right.

One of the six restriction maps shown is consistent with the pattern of bands shown in the gel.

The highlighted bands (magenta) in the gel hybridized with a probe for the gene pep during a Southern blot. Where in the gel is the pep gene located?