Table of contents

1. Introduction to Genetics51m
2. Mendel's Laws of Inheritance3h 37m
3. Extensions to Mendelian Inheritance2h 41m
4. Genetic Mapping and Linkage2h 28m
5. Genetics of Bacteria and Viruses1h 21m
6. Chromosomal Variation1h 48m
7. DNA and Chromosome Structure56m
8. DNA Replication1h 10m
9. Mitosis and Meiosis1h 34m
10. Transcription1h 0m
11. Translation58m
12. Gene Regulation in Prokaryotes1h 19m
13. Gene Regulation in Eukaryotes44m
14. Genetic Control of Development44m
15. Genomes and Genomics1h 50m
16. Transposable Elements47m
17. Mutation, Repair, and Recombination1h 6m
18. Molecular Genetic Tools19m
- Genetic Cloning
  9m
- Methods for Analyzing DNA
  9m
19. Cancer Genetics29m
- Overview of Cancer
  21m
- Cancer Mutations
  7m
20. Quantitative Genetics1h 26m
21. Population Genetics50m
- Hardy Weinberg
  19m
- Allelic Frequency Changes
  31m
22. Evolutionary Genetics29m

15. Genomes and Genomics

Bioinformatics

Genetics

15. Genomes and Genomics

Bioinformatics

Previous problemNext problem

Struggling with Genetics?

Join thousands of students who trust us to help them ace their exams!Watch the first video

Multiple Choice

Which of the following is NOT a piece of information that bioinformatics can analyze?

Location of DNA-Protein binding sites

Identifying all the proteins expressed in a skin cell

A list of all introns in the genome

The function of one gene

Previous problemNext problem

Verified step by step guidance

Understand that bioinformatics is a field that uses computational tools to analyze biological data, particularly large datasets like genomes and proteomes.

Recognize that bioinformatics can analyze DNA sequences to identify features such as DNA-protein binding sites, which are crucial for understanding gene regulation.

Acknowledge that bioinformatics can also be used to identify and catalog proteins expressed in specific cell types, such as skin cells, through techniques like transcriptomics and proteomics.

Note that bioinformatics can provide a list of introns in a genome by analyzing the genomic sequence and identifying non-coding regions within genes.

Realize that determining the function of a gene typically requires experimental validation and is not solely reliant on computational analysis, making it distinct from the other tasks listed.

8:28m

Watch next

Master Bioinformatics with a bite sized video explanation from Kylia

Start learning

Related Videos

Related Practice

Open Question

In the course of the Drosophila melanogaster genome project, the following genomic DNA sequences were obtained. Try to assemble the sequences into a single contig.

5' TTCCAGAACCGGCGAATGAAGCTGAAGAAG 3'
5' GAGCGGCAGATCAAGATCTGGTTCCAGAAC 3'
5' TGATCTGCCGCTCCGTCAGGCATAGCGCGT 3'
5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'
5' GGAGAATCGAGATGGCGCACGCGCTATGCC 3'
5' CCATCTCGATTCTCCGTCTGCGGGTCAGAT 3'

Go to the URL provided in Problem 14, and using the sequence you have just assembled, perform a blastn search in the 'Nucleotide collection (nr/nt)' database. Does the search produce sequences similar to your assembled sequence, and if so, what are they? Can you tell if your sequence is transcribed, and if it represents protein-coding sequence? Perform a tblastx search, first choosing the 'Nucleotide collection (nr/nt)' database and then limiting the search to human sequences by typing Homo sapiens in the organism box. Are homologous sequences found in the human genome? Annotate the assembled sequence.

Open Question

DNA footprint protection (described in Research Technique 8.1) is a method that determines whether proteins bind to a specific sample of DNA and thus protect part of the DNA from random enzymatic cleavage by DNase I. A 400-bp segment of cloned DNA is thought to contain a promoter. The cloned DNA is analyzed by DNA footprinting to help determine if it has the capacity to act as a promoter sequence. The accompanying gel has two lanes, each containing the cloned 400-bp DNA fragment treated with DNase I to randomly cleave unprotected DNA. Lane 1 is cloned DNA that was mixed with RNA polymerase II and several TFII transcription factors before exposure to DNase I. Lane 2 contains cloned DNA that was exposed only to DNase I. RNA pol II and TFIIs were not mixed with that DNA before adding DNase I.Approximately what length is the DNA region protected by RNA pol II and TFIIs?

Open Question

DNA footprint protection (described in Research Technique 8.1) is a method that determines whether proteins bind to a specific sample of DNA and thus protect part of the DNA from random enzymatic cleavage by DNase I. A 400-bp segment of cloned DNA is thought to contain a promoter. The cloned DNA is analyzed by DNA footprinting to help determine if it has the capacity to act as a promoter sequence. The accompanying gel has two lanes, each containing the cloned 400-bp DNA fragment treated with DNase I to randomly cleave unprotected DNA. Lane 1 is cloned DNA that was mixed with RNA polymerase II and several TFII transcription factors before exposure to DNase I. Lane 2 contains cloned DNA that was exposed only to DNase I. RNA pol II and TFIIs were not mixed with that DNA before adding DNase I.What additional genetic experiments would you suggest to verify that this region of cloned DNA contains a functional promoter?

Open Question

DNA footprint protection (described in Research Technique 8.1) is a method that determines whether proteins bind to a specific sample of DNA and thus protect part of the DNA from random enzymatic cleavage by DNase I. A 400-bp segment of cloned DNA is thought to contain a promoter. The cloned DNA is analyzed by DNA footprinting to help determine if it has the capacity to act as a promoter sequence. The accompanying gel has two lanes, each containing the cloned 400-bp DNA fragment treated with DNase I to randomly cleave unprotected DNA. Lane 1 is cloned DNA that was mixed with RNA polymerase II and several TFII transcription factors before exposure to DNase I. Lane 2 contains cloned DNA that was exposed only to DNase I. RNA pol II and TFIIs were not mixed with that DNA before adding DNase I.Explain why this gel provides evidence that the cloned DNA may act as a promoter sequence.

Multiple Choice

Which of the following can be used to identify an open-reading frame?

Open Question

Go to the National Institute for Child Health and Human Development (http://www.nichd.nih.gov), locate the search box at the top right corner of the homepage, and enter 'RUSP' to search for information on the Recommended Uniform Screening Panel. From the options that appear, select 'Brief History of Newborn Screening' and locate the discussion listing the criteria for adding a disease to the RUSP list. What are the criteria for listing a disease on the RUSP list?

Open Question

What are community-based genetic screening programs? What is the intent of such screening programs? Why are members of specific communities or populations offered the chance to participate in such programs?

Open Question

What is bioinformatics, and why is this discipline essential for studying genomes? Provide two examples of bioinformatics applications.

Show more practices

Bioinformatics practice set

Problem sets built by lead tutors

Expert video explanations

Go to Practice

Download the Mobile app

Privacy

Do not sell my personal information

Accessibility

Patent notice

Sitemap